Hi All,

I have just sourced/ remade the necessary primer sequences for the creation of pIJ794, pIJ795 and pIJ796 (these cassettes are used for replacing the neo on the cosmid backbone of supercos 1 ONLY)

Govind, I have attached the files for these cassettes to be put on ScoDB

Anyway the primers are as follows 

 
794- 796 universal forward
GATCAAGATCTGATCAAGAGACAGGATGAGGATCGTTTCGCcgccagcctcgcagagcagg
 
794 reverse
gcgtcgcttggtcggtcatttcgaaccccagagtcccgcTTATGAGCTCAGCCAATCGAC
 
795 reverse
gcgtcgcttggtcggtcatttcgaaccccagagtcccgcttatttgccgactaccttgg
 
796 reverse
gcgtcgcttggtcggtcatttcgaaccccagagtcccgcctaccggtagccgctgaggcc
These primers will need to be ordered by whoever wants to make the new cassette. To make these templates for targetting the following will need to be done. The templates for the PCR that are required for each cassette will be as follows 
pIJ794 creation requires pIJ773 as template

pIJ795 creation requires pIJ778 as template

pIJ796 creation requires pIJ780 as template
Follow the below PCR reaction using the correct template. All PCR amplifications are performed using the Expand high fidelity PCR system according to the manufacturer's instructions (Roche). Reaction conditions: 
* Primers (100 pmoles/ml)            0.5 µl each        50 pmoles each
* Template DNA (100 ng/ml)           0.5 µl             50 ng 0.06 pmoles
* Buffer (10x)                       5 µl               1 x
* dNTPs (10 mM)                      1 µl each          50 µM each
* DMSO (100 %)                       2.5 µl             5%
* DNA polymerase (2.5 U/ml)          1 µl               2.5 Units 
* Water                              36 µl
* Total volume                       50 µl
Cycle conditions: 
1. Denaturation:            94°C, 2 min 

2. Denaturation:            94°C, 45 sec

3. Primer annealing:        50°C, 45 sec      10 cycles

4. Extension:               72°C, 90 sec

5. Denaturation:            94°C, 45 sec

6. Primer annealing:        55°C, 45 sec      15 cycles

7. Extension:               72°C, 90 sec

8. Final extension:         72°C, 5 min

Once the PCR reaction has been checked for amplification the cassette can be gel purified and used as a targetting cassette as any other would be.

I hope that this helps and if anybody has an queries let me know

Thanks

Nick