On Linux, Perl/Tk is not a part of the default Perl installation. Therefore you have to download and install Perl/Tk from CPAN. You should be able to find Tk here. Look for a file titled Tk800.023.tar.gz or something similar. This is the one you need to download and install.

If you are using MS Windows and not very keen to do a proper installation of Perl (although we recommend it) then you may down load the CD version of BMW from here.

This is a zip file which you will need to unzip. We suggest you unzip the contents in a directory of their own. From this directory you can run BMW.bat. Please note that the CD version is not any different from the other version. It is just that we have put all the required files (including Perl) in a directory and zipped the contents for you to download. The configuration, default.conf file does not need editing because it is preconfigured to find the required files in the same directory. If you wish to use BMW for embl files other than we provide in the zip then you will need to modify the configuration file. You can copy the configuration file to another filename and modify it. Then you can run BMW by saying

perl bmw.pl your_config_file.

This will run BMW using the configuration you specify in your_config_file.

The configuration file has the following format:

# this is the configuration file for BMW
# you can add your comments. 
# Comments begin with a '#'
# actual data and comments cannot be on the same line

# Directory where real cosmid embl files are
embl_directory realcosmid

# directory where blast databases are
blastdb_directory blastdb

# output file to which report will be written
# Note: Output file will be a created in the temp_directory
# specified below.
opfile bmw.txt

# name of the default printer (should be postscript capable) 
# does not work in windows. Please print the report from a 
# text editor like notepad
op_printer nflethert04

# Directory to be used for writing temporary files
# The output file is also written here
temp_directory c:/temp

# location of the help file
help_file help.txt

# frt additions to primers
# make very sure you have got them right
frt_20 ATTCCGGGGATCCGTCGACC
frt_19 TGTAGGCTGGAGCTGCTTC

# the cassettes file. This is a fasta file
# make sure no two identifiers are the same
cassettes_file cassettes.fas